Skip to content
This repository was archived by the owner on Oct 6, 2025. It is now read-only.

Primer design fixes#1

Open
daz10000 wants to merge 9 commits intoAmyris:masterfrom
demetrixbio:primer_dimer
Open

Primer design fixes#1
daz10000 wants to merge 9 commits intoAmyris:masterfrom
demetrixbio:primer_dimer

Conversation

@daz10000
Copy link
Copy Markdown

@daz10000 daz10000 commented Nov 3, 2017

The primer designer has never really taken care of self dimers during design and does in practice make bad oligos. For example the CTTTAAAG in the tail of this oligo can anneal to itself (oligo on opposite strand) and prime to make a dimer.

TTAAGTCGAAACCTAGTGCTCCGCTATTCTTGCCTACGGTTGGGCTTAA**CTTTAAAG**

In addition, there were deficiencies in the GC clamp finding that sometimes the designer would ignore an obvious opportunity to end a primer on a G or a C. This patch fixes these cases and adds a bunch of tests. Regression testing was done against a large set of designs and all the changes inspected to ensure the algorithm is behaving as designed/intended. This will likely result in small changes to oligo designs relative to historical output. The most common changes will be a 1 or 2 bp change in length to end on a G/C or to avoid a terminal palindrome.

Copy link
Copy Markdown
Contributor

@chrismacklin chrismacklin left a comment

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Great improvement overall, I will work on validating the change against internal regression standards to get ready for merge.

Comment thread src/AmyrisBio/primercore2.fs
Comment thread src/AmyrisBio/primercore2.fs Outdated
let disruptPrimerDimers (debug:bool) (existingTemp : float<C>) (p:PrimerParams) (s:char[]) f t offset =
if debug then
printfn "disruptPrimerDimers: checking for problems"
let comp (b:char) = match b with | 'G' -> 'C' | 'C' -> 'G' | 'A' -> 'T' | 'T' -> 'A' | x -> x
Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

There is a suite of basepair-wise complement functions in biolib.fs; is there some reason that one of those existing functions is insufficient here?

Copy link
Copy Markdown
Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I missed that first time I looked. replaced with rcBase

Comment thread src/AmyrisBio/primercore2.fs Outdated
Comment thread src/AmyrisBio/primercore2.fs Outdated
Comment thread src/AmyrisBio/primercore2.fs Outdated
if seq { 0..i-1 } |> Seq.forall (fun j -> s.[t'-i+j] = comp (s.[t'-j])) then
yield (i+1)
} |> Seq.tryFind(fun x -> x<> 0)
|> function | None -> 0 | Some v -> v
Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

There's a builtin for this:

|> Option.defaultValue 0

Copy link
Copy Markdown
Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

good catch.

Copy link
Copy Markdown
Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Actually - couldn't find that method, but there is a defaultArg function that I ended up using. Let me know if I'm missing something

Comment thread src/AmyrisBio/primercore2.fs Outdated
Comment thread src/AmyrisBio/primercore2.fs Outdated
Comment thread src/AmyrisBio/primercore2.fs Outdated
Comment thread tests/AmyrisBio.Tests/testPrimer.fs Outdated
Comment thread tests/AmyrisBio.Tests/testPrimer.fs Outdated
"AAACAGTATATGTACAGTTTTATATATATATATATATATATATACATATATAAAG" ;
"AAAAAATCTTAATAGATTAATTTAAACAGTATATGTACAGTTTTATATATATATATATATATATATACATATATAAAG" ;
]
let pen= {
Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

There is a lot of code duplication between these two test suites; it would be great to extract this record to the test class, as well as the let task = ... expression below.

Copy link
Copy Markdown
Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

deduped code and the shared templates

@daz10000
Copy link
Copy Markdown
Author

Ok - all addressed. I ended up bumping the versioning to .Net 4.6.1 like the other libraries while trying to find Option.defaultarg and can revert if this is aproblem. We should be moving over to dotnetcore soon anyway

@daz10000
Copy link
Copy Markdown
Author

I ended up switching it back to 4.5 after the 4.6.1 update broke a bunch of things. Probably better to minimize the changes here.

Sign up for free to subscribe to this conversation on GitHub. Already have an account? Sign in.

Labels

None yet

Projects

None yet

Development

Successfully merging this pull request may close these issues.

2 participants